repeatedDNASequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T. In research, it can be useful to identify repeated sequences within DNA.

Write a function to find all the 10-letter sequences (substrings) that occur more than once in a DNA molecule s, and return them in lexicographical order. These sequences can overlap.

Example

For s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", the output should be repeatedDNASequences(s) = ["AAAAACCCCC", "CCCCCAAAAA"].

Input/Output

[execution time limit] 4 seconds (php)

[input] string s

Guaranteed constraints:

0 ≤ s.length ≤ 5000.

[output] array.string